I have a test program that gives different results when executing more than one goroutine on more than one Cpu (Goroutines = Cpus). The "test" is about syncing goroutines using channels, and the program itself counts occurences of chars in strings. It produces consistent results on one Cpu / one goroutine.
See code example on playground (Note: Run on local machine to execute on multi core, and watch the resulting numbers vary): http://play.golang.org/p/PT5jeCKgBv .
Code summary: The program counts occurences of 4 different chars (A,T, G,C) in (DNA) strings.
Problem: Result (n occurences of chars) varies when executed on multiple Cpu's (goroutines). Why?
Description:
- A goroutine spawns work (SpawnWork) as strings to Workers. Sets up artificial string input data (hardcoded strings are copied n times).
- Goroutine Workers (Worker) are created equalling the numbers of Cpu's.
- Workers checks each char in string and counts A,T's and sends the sum into a channel, and G,C counts to another channel.
- SpawnWork closes workstring channel as to control Workers (which consumes strings using range, which quits when the input channel is closed by SpawnWork).
- When Workers has consumed its ranges (of chars) it sends a quit signal on the quit channel (quit <- true). These "pulses" will occure Cpu number of times ( Cpu count = goroutines count).
- Main (select) loop will quit when it has received Cpu-count number of quit signals.
- Main func prints a summary of occurences of Chars (A,T's, G,C's).
Simplified code:
1. "Worker" (goroutines) counting chars in lines:
func Worker(inCh chan *[]byte, resA chan<- *int, resB chan<- *int, quit chan bool) {
//for p_ch := range inCh {
for {
p_ch, ok := <-inCh // similar to range
if ok {
ch := *p_ch
for i := 0; i < len(ch); i++ {
if ch[i] == 'A' || ch[i] == 'T' { // Count A:s and T:s
at++
} else if ch[i] == 'G' || ch[i] == 'C' { // Count G:s and C:s
gc++
}
}
resA <- &at // Send line results on separate channels
resB <- &gc // Send line results on separate channels
} else {
quit <- true // Indicate that we're all done
break
}
}
}
2. Spawn work (strings) to workers:
func SpawnWork(inStr chan<- *[]byte, quit chan bool) {
// Artificial input data
StringData :=
"NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
" +
"NTGAGAAATATGCTTTCTACTTTTTTGTTTAATTTGAACTTGAAAACAAAACACACACAA
" +
"... etc
" +
// ...
for scanner.Scan() {
s := scanner.Bytes()
if len(s) == 0 || s[0] == '>' {
continue
} else {
i++
inStr <- &s
}
}
close(inStr) // Indicate (to Workers) that there's no more strings coming.
}
3. Main routine:
func main() {
// Count Cpus, and count down in final select clause
CpuCnt := runtime.NumCPU()
runtime.GOMAXPROCS(CpuCnt)
// Make channels
resChA := make(chan *int)
resChB := make(chan *int)
quit := make(chan bool)
inStr := make(chan *[]byte)
// Set up Workers ( n = Cpu )
for i := 0; i < CpuCnt; i++ {
go Worker(inStr, resChA, resChB, quit)
}
// Send lines to Workers
go SpawnWork(inStr, quit)
// Count the number of "A","T" & "G","C" per line
// (comes in here as ints per row, on separate channels (at and gt))
for {
select {
case tmp_at := <-resChA:
tmp_gc := <-resChB // Ch A and B go in pairs anyway
A += *tmp_at // sum of A's and T's
B += *tmp_gc // sum of G's and C's
case <-quit:
// Each goroutine sends "quit" signals when it's done. Since
// the number of goroutines equals the Cpu counter, we count
// down each time a goroutine tells us it's done (quit at 0):
CpuCnt--
if CpuCnt == 0 { // When all goroutines are done then we're done.
goto out
}
}
}
out:
// Print report to screen
}
Why does this code count consistently only when executed on a singel cpu/goroutine? That is, the channels doesn't seem to sync, or the main loop quits forcefully before all goroutines are done? Scratching head.
(Again: See/run the full code at the playground: http://play.golang.org/p/PT5jeCKgBv )
// Rolf Lampa